View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13978_low_24 (Length: 332)

Name: NF13978_low_24
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13978_low_24
NF13978_low_24
[»] chr6 (4 HSPs)
chr6 (125-284)||(15514489-15514648)
chr6 (41-124)||(15512636-15512719)
chr6 (41-124)||(16327899-16327982)
chr6 (41-124)||(16351321-16351401)


Alignment Details
Target: chr6 (Bit Score: 124; Significance: 9e-64; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 125 - 284
Target Start/End: Original strand, 15514489 - 15514648
Alignment:
125 acgaataacaaccaatgcaagacaaacacgaaccgataccatttttggaaccggagcaaatgtctcattaaaatcaatactagcaacttgattgttgcca 224  Q
    |||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||  |||| |||||| | |||||||||||||||||    
15514489 acgaataacaaccaatgcaagaaaaacacgaaccgataccatttttgcaaccggagcaaatgtctcaaaaaaaccaataccaacaacttgattgttgcca 15514588  T
225 ataataacaagatgtgctttgtgtcgttcaatagtaccattgcaacagctcgattttcgt 284  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||    
15514589 ataataacaagatgtgctttgtgtcgttcaatagtaccattgtaacagcttgattttcgt 15514648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 41 - 124
Target Start/End: Original strand, 15512636 - 15512719
Alignment:
41 ggctggctattgatggtactgaaaagaaggtttacgatgatggttggtttgaacttattggatacaagaaaacgggatacctta 124  Q
    ||||||||||||||||||||| |||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||    
15512636 ggctggctattgatggtactggaaagaaggtttatgatgatggctggtttgaaattattggatacaagaaaacgggatacctta 15512719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 41 - 124
Target Start/End: Complemental strand, 16327982 - 16327899
Alignment:
41 ggctggctattgatggtactgaaaagaaggtttacgatgatggttggtttgaacttattggatacaagaaaacgggatacctta 124  Q
    ||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||| |||| ||| ||| ||||| ||||    
16327982 ggctggctattgatggtactggaaagaatgtttatgatgatggttggtttgaacttattgcatacgagagaaccggatatctta 16327899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 41 - 124
Target Start/End: Complemental strand, 16351401 - 16351321
Alignment:
41 ggctggctattgatggtactgaaaagaaggtttacgatgatggttggtttgaacttattggatacaagaaaacgggatacctta 124  Q
    ||||||||||||||||||||| |||||| ||| |   |||||||||||||||||||| | ||||||||| | ||||||||||||    
16351401 ggctggctattgatggtactggaaagaatgttca---tgatggttggtttgaacttactagatacaagagatcgggatacctta 16351321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University