View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13978_low_28 (Length: 303)
Name: NF13978_low_28
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13978_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 186; Significance: 1e-101; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 17148767 - 17148960
Alignment:
| Q |
1 |
atgccaaatttatgtaaccaaccataacttgccatccacatccaatgaccacacctaaatattcttataaaagttattataatttaaataacggtgtaat |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17148767 |
atgccaagtttatgtaaccaaccataacttgccatccacatccaatgaccacacctaaatattcttataaaagttattataatttaaataacggtgtaat |
17148866 |
T |
|
| Q |
101 |
atcactcttgagagtgaaggcttatatgttatggtatggatcaaaggtttagtagcaatttttggtctcttgttttataacgcaaataaaataa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17148867 |
atcactcttgagagtgaaggcttatatgttatggtatgcatcaaaggtttagtagcaatttttggtctcttgttttataacgcaaataaaataa |
17148960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 230 - 280
Target Start/End: Original strand, 17148968 - 17149018
Alignment:
| Q |
230 |
tggtatgcatcaaagttatggtgagtctgagactatatgttataaattaaa |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17148968 |
tggtatgcatcaaagttatggtgagtctgagactatatgttataaattaaa |
17149018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 4 - 57
Target Start/End: Original strand, 17134910 - 17134963
Alignment:
| Q |
4 |
ccaaatttatgtaaccaaccataacttgccatccacatccaatgaccacaccta |
57 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17134910 |
ccaagtttatgtaaccaaccataacttgccatccacatccaatgaccacaccta |
17134963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 17166511 - 17166567
Alignment:
| Q |
1 |
atgccaaatttatgtaaccaaccataacttgccatccacatccaatgaccacaccta |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
17166511 |
atgccaaatttatgtaaccaaccataacttgccacccacatccaattaccacaccta |
17166567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University