View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13978_low_42 (Length: 249)
Name: NF13978_low_42
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13978_low_42 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 13 - 249
Target Start/End: Complemental strand, 16585901 - 16585648
Alignment:
| Q |
13 |
aatatgaaaggttaaagatgtggatggggtggattgaattatttatccataattgttttcccatgtcacttcattattttgtttttatttgtttattgat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16585901 |
aatatgaaaggttaaagatgtggatggggtggattgaattatttatccataattgttttcccatgtcacttcattattttgtttttatttgtttattgat |
16585802 |
T |
|
| Q |
113 |
taattt----------------acatcaagactaattttcatttgcccctttatgcaatacaaacgacgcaatttatcaaatttgagacacaacttaaat |
196 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16585801 |
taatttgctaaccaaccaggttacatcaagactaattttcatttgcccctttatgcactacaaacgacgcaatttatcatatttgagacacaacttaaat |
16585702 |
T |
|
| Q |
197 |
gcttta-ttattcaaatggaacaaattgaattcttaatatgtataaaagtcaaa |
249 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16585701 |
gctttatttattcaaatggaacaaattgaattcttaatatgtataaaagtcaaa |
16585648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University