View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13978_low_44 (Length: 241)
Name: NF13978_low_44
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13978_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 28 - 197
Target Start/End: Complemental strand, 48231378 - 48231209
Alignment:
| Q |
28 |
cacagactcagacaccgattcattgcaggtaagcaagagcgcagatgcagacaccgcaggaggctcaaaggctggatcactttatacgaatgaacaaagt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48231378 |
cacagactcagacaccgattcattgcaggtaagcaagagcgcagatgcagacaccgcaggaggctcaaaggctggatcactttatacgaatgaacaaagt |
48231279 |
T |
|
| Q |
128 |
gatggcttagaatatgcaattgacaaatatagaaaacttgggctcaaaattggtcctgaaatgtggaaac |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48231278 |
gatggcttagaatatgcaattgacaaatatagaaaacttgggctcaaaattggtcctgaaatgtggaaac |
48231209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 28 - 197
Target Start/End: Complemental strand, 48236418 - 48236249
Alignment:
| Q |
28 |
cacagactcagacaccgattcattgcaggtaagcaagagcgcagatgcagacaccgcaggaggctcaaaggctggatcactttatacgaatgaacaaagt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236418 |
cacagactcagacaccgattcattgcaggtaagcaagagcgcagatgcagacaccgcaggaggctcaaaggctggatcactttatacgaatgaacaaagt |
48236319 |
T |
|
| Q |
128 |
gatggcttagaatatgcaattgacaaatatagaaaacttgggctcaaaattggtcctgaaatgtggaaac |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48236318 |
gatggcttagaatatgcaattgacaaatatagaaaacttgggctcaaaattggtcctgaaatgtggaaac |
48236249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University