View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13978_low_47 (Length: 238)
Name: NF13978_low_47
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13978_low_47 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 38093391 - 38093170
Alignment:
| Q |
18 |
gaatgtactttctttattgaattatgagaatcgaatacaacacatagatgtagagagaagcttacttatatattctatatatgtaaaaaagtctcatcac |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38093391 |
gaatgtactttctttattgaattataagaatcgaatacaacacatagatgtaaagagaagcttacttatatatactatatatgtaaaaaagtctcatcac |
38093292 |
T |
 |
| Q |
118 |
atcggttgcaaattcctatttaaacagtcactaattacaaacttaacgagctcactg-tatttccaatctaaggaatatttcatgttaggaaatttctct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38093291 |
atcggttgcaaattcctatttaaacagtcactaattacaaacttaacgagctcactgttttttccaatctaaggaatatttcatgttaggaaatttgtct |
38093192 |
T |
 |
| Q |
217 |
cttttgcttctctaattctctt |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38093191 |
cttttgcttctctaattctctt |
38093170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University