View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13978_low_51 (Length: 236)
Name: NF13978_low_51
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13978_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 230
Target Start/End: Complemental strand, 42799320 - 42799105
Alignment:
| Q |
15 |
tgtactatatcatataagctctcattgcattgaaccttgtcaagtatgaattctgcataactctagtgcatacagagtaaaatgctatcttgcatttctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42799320 |
tgtactatatcatataagctctcattgcattgaaccttgtcaagtatgaattctgcataactctagtgcatacagagtaaaatgctatcttgcatttctt |
42799221 |
T |
 |
| Q |
115 |
aaatgtgtgtgcatatatggaaaatgcttcaaaatagttatttcatttcccctttcaagtaaagcaagcttgtcgatcttgatgaacttgacaatggatc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
42799220 |
aaatgtgtgtgcatatatggaaaatgcttcaaaatagttatttcatttcccctttcaagtaaagtaaacttgtcgatcttgatgaacttgacaatggatc |
42799121 |
T |
 |
| Q |
215 |
gtttcattcttttcag |
230 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42799120 |
gtttcattcttttcag |
42799105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University