View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13978_low_53 (Length: 234)
Name: NF13978_low_53
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13978_low_53 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 7 - 226
Target Start/End: Complemental strand, 8496605 - 8496386
Alignment:
| Q |
7 |
ggaacaatctctttaatcacgaaactaattgcacaaagtggcaatgatctcgagnnnnnnnnctattataagagttgtttgactttttatgcagaggatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8496605 |
ggaacaatctctttaatcacgaaactaattgcacaaagtggcaatgatctcgagaaaaaaaactattataagagttgtttgactttttatgcagaggatg |
8496506 |
T |
 |
| Q |
107 |
aaggagctcttggtgagattgaggaagcacaagacctcttgaaccgttctgattacaatggtgttaatgtgcatatcagtggtgtcatgagcgatgttta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8496505 |
aaggagctcttggtgagattgaggaagcacaagacctcttgaaccgttctgattacaatggtgttaatgtgcatatcagtggtgtcatgagcgatgttta |
8496406 |
T |
 |
| Q |
207 |
taactgccgtactgatgatg |
226 |
Q |
| |
|
||||||| |||||| ||||| |
|
|
| T |
8496405 |
taactgcggtactggtgatg |
8496386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University