View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13978_low_62 (Length: 206)
Name: NF13978_low_62
Description: NF13978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13978_low_62 |
 |  |
|
| [»] scaffold0181 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0181 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: scaffold0181
Description:
Target: scaffold0181; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 46 - 143
Target Start/End: Complemental strand, 16734 - 16637
Alignment:
| Q |
46 |
ctcttctactgatgtctaattcagtccactatcttcctcaaagatcaaaggggatgctttgtgcatcaaaattacacaagaggactatgaaatgggta |
143 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16734 |
ctcttctactgatgtctaatttagtccactatcttccccaaagatcaaaggggatgctttgtgcatcaaaattacacaagaggactatgaaatgggta |
16637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University