View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13979_high_8 (Length: 237)
Name: NF13979_high_8
Description: NF13979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13979_high_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 17 - 228
Target Start/End: Original strand, 2222918 - 2223129
Alignment:
| Q |
17 |
caaaggaatgaccagaggagacaattacaggatcagacatgagagaacctgaaatggggcatagaaattcttgaggtgggttttggttttgggtagtttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2222918 |
caaaggaatgaccagaggagacaattacaggatcagacatgagagaacctgaaatggggcatagaaattcttgaggtgggttttggttttgggtagcttt |
2223017 |
T |
|
| Q |
117 |
tgttgtgttgaagaatatcatcattttcttccatttcatctttggagtagttgttgtaattggttctaatgattttgattccttttttgtacttccccat |
216 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| | || |||||| |
|
|
| T |
2223018 |
tgttgtgttgaagaaaatcatcattttcttccatttcatctttggagtagtagttgcaattggttctaatgattttgattcctttttggaaccaccccat |
2223117 |
T |
|
| Q |
217 |
ttcttgtctgtg |
228 |
Q |
| |
|
||||||| |||| |
|
|
| T |
2223118 |
ttcttgtttgtg |
2223129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University