View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1397_high_3 (Length: 404)
Name: NF1397_high_3
Description: NF1397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1397_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 258 - 390
Target Start/End: Original strand, 52874332 - 52874464
Alignment:
| Q |
258 |
catatatttctattagattcctttttgcacgagatttacaattggttgattttaaattgcccatttcagtggaagttctactatatgctccaactcgtcc |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874332 |
catatatttctattagattcctttttgcacgagatttacaattggttgattttgaattgcccatttcagtggaagttctactatatgctccaactcgtcc |
52874431 |
T |
 |
| Q |
358 |
aactatagatttctctgttggatgtttgtggtt |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52874432 |
aactatagatttctctgttggatgtttgtggtt |
52874464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University