View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1397_low_10 (Length: 204)
Name: NF1397_low_10
Description: NF1397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1397_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 27154627 - 27154687
Alignment:
| Q |
1 |
tccttgctacaccatagaaacaatgctcactccccagtttgctctcggtgtggtctctctg |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27154627 |
tccttgctacaccatagaaacaatgctcactcccaagtttgctctcggtgtggtctctctg |
27154687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University