View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1397_low_3 (Length: 404)

Name: NF1397_low_3
Description: NF1397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1397_low_3
NF1397_low_3
[»] chr1 (1 HSPs)
chr1 (258-390)||(52874332-52874464)


Alignment Details
Target: chr1 (Bit Score: 129; Significance: 1e-66; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 258 - 390
Target Start/End: Original strand, 52874332 - 52874464
Alignment:
258 catatatttctattagattcctttttgcacgagatttacaattggttgattttaaattgcccatttcagtggaagttctactatatgctccaactcgtcc 357  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
52874332 catatatttctattagattcctttttgcacgagatttacaattggttgattttgaattgcccatttcagtggaagttctactatatgctccaactcgtcc 52874431  T
358 aactatagatttctctgttggatgtttgtggtt 390  Q
    |||||||||||||||||||||||||||||||||    
52874432 aactatagatttctctgttggatgtttgtggtt 52874464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University