View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13980_low_3 (Length: 229)
Name: NF13980_low_3
Description: NF13980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13980_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 31 - 211
Target Start/End: Original strand, 28022775 - 28022955
Alignment:
| Q |
31 |
gagatgaaacagaaacagttactctcattgttgatccactgccatcagacctgaaactacatgttttagtgaagtttcttggccatggcagcaatggcta |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28022775 |
gagatgaaacagaaacagttactctcattgttgatccgctgccatcagacctgaaactacatgttttagtgaagtttcttggccatggcagcaatggcta |
28022874 |
T |
|
| Q |
131 |
tgtgagggtgaaggagaccgataaggtgagtgacctgtgcgacaaagtttcacgatattggggcattccccttgatacttt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28022875 |
tgtgagggtgaaggagaccgataaggtgagtgacctgtgcaacaaagtttcacggtattggggcattccccttgatacttt |
28022955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University