View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13981_low_12 (Length: 208)
Name: NF13981_low_12
Description: NF13981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13981_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 25731867 - 25732044
Alignment:
| Q |
15 |
aatatgattttgaaataactatggaaattggcgtaggtatatgaggctaaaagtggccatgaaagtccaggacctgttggtgaagtgctttgaattcata |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25731867 |
aatatgattttgaaataactatggaaattggtgtaggtatatgaggctaaaagtggccatgaaagtccaggacccgttggtgaagtgctttgaattcata |
25731966 |
T |
 |
| Q |
115 |
ttagacgatggaactgcggtaacggtgaatttcctctatgagaaaattgggaatttttgtaatgtttgtggtctgatt |
192 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25731967 |
ttagatgatggaactgcggtaacggtgaatttcctctatgagaaacttgggaatttttgtaatgtttgtggtctgatt |
25732044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 16940946 - 16940883
Alignment:
| Q |
15 |
aatatgattttgaaa-taactatggaaattggcgtaggtatatgaggctaaaagtggccatgaa |
77 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| | || | |||||||||||| |
|
|
| T |
16940946 |
aatatgattttgaaaataactatggaaattggcgtaggtatatgcgactgagagtggccatgaa |
16940883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University