View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13981_low_4 (Length: 446)
Name: NF13981_low_4
Description: NF13981
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13981_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 4e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 14 - 167
Target Start/End: Complemental strand, 24952787 - 24952634
Alignment:
| Q |
14 |
atgaacgggccataggaaataatgtacaatagtatttagtattaaacattgtttcttcactcacattttttcaaaacaaagagatcctctctcaacactt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24952787 |
atgaacgggccataggaaataatgtacagtagtatttagtattaaacattgtttcttcactcacattttttcaaaacaaagagatcctctctcaacactt |
24952688 |
T |
 |
| Q |
114 |
ttgttctttcgaagttacttgtgttgcggccactagaaaatagctcatattagg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24952687 |
ttgttctttcgaagttacttgtgttgcggccactagaaaatagctcatattagg |
24952634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University