View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13982_high_28 (Length: 239)
Name: NF13982_high_28
Description: NF13982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13982_high_28 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 4191289 - 4191510
Alignment:
| Q |
19 |
tctaaataacacggctgtcttctatatacatatgcaaaaatatcttatcataagcaaaacatccaacctagttaaaaaggttatattactgtctgcaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4191289 |
tctaaataacacggctgtcttctatatacatatgcaaaaatatcttatcataagcaaaacatccaacctagttaaaaaggttatattactgtctgcaatg |
4191388 |
T |
 |
| Q |
119 |
ag-annnnnnnnactgaatactgttgatattaaattgcaattagaaatattaagttgttacgagcaaaggcttgtaaattagttttccatttcacttctc |
217 |
Q |
| |
|
|| | ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4191389 |
agaattttttttactgaatactgttgatattaaattgcaattagaaatattaagtatttacgagcaaaggcttgtaaattagttttccatttcacttctc |
4191488 |
T |
 |
| Q |
218 |
atcctatgaatacataaatctc |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4191489 |
atcctatgaatacataaatctc |
4191510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University