View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13982_high_31 (Length: 211)
Name: NF13982_high_31
Description: NF13982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13982_high_31 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 21 - 211
Target Start/End: Complemental strand, 22569958 - 22569773
Alignment:
| Q |
21 |
tgaagcattaaacagtatcaggcatattaattaagcagatttattctttcagagttcagaccctcattatgcagtacttaaattaattaagacacgtcaa |
120 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22569958 |
tgaagcattaagcagtatcaggcatattaattaagcagatttattctttcaga-------ccctcattatgcagtacttaaattaattaagacacgtcaa |
22569866 |
T |
 |
| Q |
121 |
cactcattgggtggagaatatcctaaaatgcaactatccaccataacagcct--tatgttattgaggcacttctgttctgaataactagccaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||| |||||| |
|
|
| T |
22569865 |
cactcattgggtggagaatatcctaaaatgcaactatccaccataacagccttatattttattaaggcacttctgttctgaataaccagccaa |
22569773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University