View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13982_low_14 (Length: 473)
Name: NF13982_low_14
Description: NF13982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13982_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 2 - 327
Target Start/End: Original strand, 8288505 - 8288819
Alignment:
| Q |
2 |
caataatatcagcatggtattgtattagatgagatattctgacttgtaaggtcgagatctcgaccacttataaacacatattcatatcatatgtacgtta |
101 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
8288505 |
caataaaatcagcatggtattgtattagatgagatattctgacttgtaaggtcgagatctcgaccacttataaacacatat-----------gtatgtta |
8288593 |
T |
 |
| Q |
102 |
tttaaggtgtatgtacctgcataaatcatattctcattgcaatcaatttacttgcagctgaacaattcagtatcaaggggtatgtacctgcatatttgga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8288594 |
tttaaggtgtatgtacctgcataaatcatattctcattgcaatcaatttacttgcagctgaacaattcggtatcaaggggtatgtacctgcatatttgga |
8288693 |
T |
 |
| Q |
202 |
tccaaatctcaaatccagtgatcttcttacaggcgtaggctttgcctccggagcttcaggatatgatcctttgacaccacaaatagcggtaaataaaaac |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8288694 |
tccaaatctcaaatccagtgatcttcttacaggcgtaggctttgcctccggagcttcaggatatgatcctttgacaccacaaatagcggtaaataaaaac |
8288793 |
T |
 |
| Q |
302 |
ttatatttgagatatatttaaaattt |
327 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8288794 |
ttatatttgagatatatttaaaattt |
8288819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 384 - 455
Target Start/End: Original strand, 8288815 - 8288886
Alignment:
| Q |
384 |
aatttgatgttaaaatagactttagtgtgggtcgaaattgataattgctattgaccattgttttgtgaattg |
455 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8288815 |
aatttgatgttaaaattgactttagtgtgggtggaaattgataattgctattgaccattgttttgtgaattg |
8288886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University