View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13982_low_20 (Length: 330)
Name: NF13982_low_20
Description: NF13982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13982_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 39310471 - 39310312
Alignment:
| Q |
1 |
tacaaaagtcgggaaggtctgttgcaggccttcaacaattcaaatggcccactcatttttgttggtaagacaactttctttctgttcatttggcgttgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39310471 |
tacaaaagtcgggaaggtctgttgcaggccttcaacaattcaaatggcccactcatttttgttggtaagacaactttctttctgttcgtttggcgttgca |
39310372 |
T |
|
| Q |
101 |
ttagatacttcacacttataaaccttcaataatcaatatcaacttcataaaaacccttgaatgcata |
167 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39310371 |
ttagatacttcacacttataaaccttc-------aatatcaacttcataaaaacccttgaatgcata |
39310312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 250 - 313
Target Start/End: Complemental strand, 39310314 - 39310251
Alignment:
| Q |
250 |
atattattgtgcgtatctattttgaacatgaatctcaattcactgtgtttttctgaggagttga |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39310314 |
atattattgtgcgtatctattttgaacatgaatctcaattcactgtgtttttctgaggagttga |
39310251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University