View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13982_low_31 (Length: 236)

Name: NF13982_low_31
Description: NF13982
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13982_low_31
NF13982_low_31
[»] chr2 (1 HSPs)
chr2 (1-171)||(37658272-37658442)


Alignment Details
Target: chr2 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 171
Target Start/End: Original strand, 37658272 - 37658442
Alignment:
1 gaaaatggtgatttggnnnnnnngctatggacctatggtaggaagattcggtacttatgaaaccgtttttatgttgcagtcgattccgtactcttagatt 100  Q
    ||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37658272 gaaaatggtgatttggaaaaaaagctatggacctatggtaggaagattcggtacttatgaaaccgtttttatgttgcagtcgattccgtactcttagatt 37658371  T
101 aagagaatatgtaatttcttaatctattagcaaacaatcggctgcactataaattcagttgtagacaattc 171  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
37658372 aagagaatatgtaatttcttaatctattagcaaacaatcggctgcactacaaattcagttgtagacaattc 37658442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University