View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13983_high_20 (Length: 276)
Name: NF13983_high_20
Description: NF13983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13983_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 28 - 258
Target Start/End: Complemental strand, 44674766 - 44674536
Alignment:
| Q |
28 |
gcacttcgaacggagtagcagccattccgttatgctttccaaactaaatgatccgtttgaacttgttcgaaaagaggggtatgtaaaatactatcagcaa |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44674766 |
gcacttcgaacggagtagcagccattccgttatgctttctaaactaaatgatacgtttgaacttgttcgaaaagaggggtatgtaaaatactatcagcaa |
44674667 |
T |
|
| Q |
128 |
catcgtgactgaaaacctgtcgaaccagaggcgtattccactcttttcgttgtgcagacatcaaactctgaaccgtaaatccttgaacaaaatgacctcc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44674666 |
catcgtgactgaaaacctgtcgaaccagaggcgtattccactctttccgttgtgcagacatcaaactctgaaccgtaaatccttgaacaaaatgacctcc |
44674567 |
T |
|
| Q |
228 |
ctcaatgttctcatcaatacacgcaccatta |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44674566 |
ctcaatgttctcatcaatacacgcaccatta |
44674536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University