View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13983_high_25 (Length: 237)
Name: NF13983_high_25
Description: NF13983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13983_high_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 51 - 220
Target Start/End: Original strand, 46939484 - 46939653
Alignment:
| Q |
51 |
taattaatatataaatagagatgtgaaaattaaagcataattagcatataccttcttaatgttatgagcaatgtgtttggagctaaactcctcaagacta |
150 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46939484 |
taataaatatataaatagagatgtgaaaattaaagcataattagcatataccttcttaatgttatgagcaatgtgtttggagctaaactcctcaagacta |
46939583 |
T |
|
| Q |
151 |
tcatatgtccttcttgcacaacgaaaagcatgcacttgcatgaaacttggcatgtctgagaccaaaacct |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46939584 |
tcatatgtccttcttgcacaacgaaaagcatgcacttgcatgaaacttggcatgtctgagaccaaaacct |
46939653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University