View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13983_low_16 (Length: 406)
Name: NF13983_low_16
Description: NF13983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13983_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 330
Target Start/End: Original strand, 32482426 - 32482755
Alignment:
| Q |
1 |
aaacacggtatcccataaaccatttttcacaaatcccaattaattctctctcaactgtttcttgatttctcatgttctttgtaccnnnnnnnnnnnncct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
32482426 |
aaacacggtatcccataaaccatttttcacaaatcccaattaattctctctcaactgtttcttgatttctcatgttctttgtaccaaaaacaaaaaacct |
32482525 |
T |
 |
| Q |
101 |
atttaggtttttgatatggaaattgagacacaattaaagaaactattgttgttagggttaaggnnnnnnncttcaaagaaatggctggtttgttctcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32482526 |
atttaggtttttgatatggaaattgagacacaattaaagaaagtattgttgttagggttaaggtttttttcttcaaagaaatggctggtttgttctcatt |
32482625 |
T |
 |
| Q |
201 |
aggtggaggtggaagaggaaaccaaggagaagaatcacaacaacaaggtcatattccaccacaagagacactattttggtacaacaaaaacgatgatgtt |
300 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482626 |
aggaggaggtggaagaggaaaccaaggagaagaatcacaacaacaaggtcatattccaccacaagagacactattttggtacaacaaaaacgatgatgtt |
32482725 |
T |
 |
| Q |
301 |
tcatcttacagaggtaatttagaattatgg |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32482726 |
tcatcttacagaggtaatttagaattatgg |
32482755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 367 - 396
Target Start/End: Original strand, 32482792 - 32482821
Alignment:
| Q |
367 |
gatgatatgcatgctgcacggccgttcttc |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32482792 |
gatgatatgcatgctgcacggccgttcttc |
32482821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University