View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13983_low_25 (Length: 291)
Name: NF13983_low_25
Description: NF13983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13983_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 157 - 275
Target Start/End: Complemental strand, 2317672 - 2317554
Alignment:
| Q |
157 |
aatagcataatcttagttcccttatgttgtgtgaaactgtttagaaacaagaattagaatagtttatggaataataatttgactttcttttggttgaatt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2317672 |
aatagcataatcttagttcccttatgttgtgtgaaactgtttagaaacaagaattagaatagtttatggaataataatttgactttcttttggttgaatt |
2317573 |
T |
|
| Q |
257 |
gaacttcaaagggataaga |
275 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2317572 |
gaacttcaaagggataaga |
2317554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 14 - 76
Target Start/End: Complemental strand, 2317808 - 2317746
Alignment:
| Q |
14 |
caccaccaccggaaaatgaatcaactgaacttcaaggtaaattctttaattttatacttcaag |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2317808 |
caccaccaccggaaaatgaatcaactgaacttcaaggtaaattctttaatttcatacttcaag |
2317746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University