View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13983_low_27 (Length: 279)
Name: NF13983_low_27
Description: NF13983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13983_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 74 - 240
Target Start/End: Original strand, 35679 - 35845
Alignment:
| Q |
74 |
catacttggataacaacccatatgatatacacctaggatataaagttgttaattataaccttttatcacttgattgaaatcacttgtccctttttgtctc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35679 |
catacttggataacaacccatatgatatacacctaggatataaagttgttaattataaccttttatcacttgattgaaatcacttgtccctttttgtctc |
35778 |
T |
 |
| Q |
174 |
ctttcatgtctattcttttgaaaaatgacaatttgtcacattgttttcaaactcgtatgttcatctc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35779 |
ctttcatgtctattcttttgaaaaatgacaatttgtgacattgttttcaaactcgtatgttcatctc |
35845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University