View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13983_low_30 (Length: 257)
Name: NF13983_low_30
Description: NF13983
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13983_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 2 - 239
Target Start/End: Complemental strand, 32482449 - 32482212
Alignment:
| Q |
2 |
aatggtttatgggataccgtgttttgtgtgcgtctccagaaaattacacaaaacaaaacacagagaaaatgaaaacataagtatatgtctccttgttatg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482449 |
aatggtttatgggataccgtgttttgtgtgcgtctccagaaaattacacaaaacaaaacacagagaaaatgaaaacataagtatatgtctccttgttatg |
32482350 |
T |
|
| Q |
102 |
gttgggaaaagagtatagtaattgaattgaattgaagttaataagaaaaagaaggacagaaaacagaaacagacggctaaacagtgtcgtggcagcaagc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482349 |
gttgggaaaagagtatagtaattgaattgaattgaagttaataagaaaaagaaggacagaaaacagaaacagacggctaaacagtgtcgtggcagcaagc |
32482250 |
T |
|
| Q |
202 |
agcgttaatcacgctttcaatatcacttcccagctagc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482249 |
agcgttaatcacgctttcaatatcacttcccagctagc |
32482212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 24 - 57
Target Start/End: Complemental strand, 11308535 - 11308502
Alignment:
| Q |
24 |
tttgtgtgcgtctccagaaaattacacaaaacaa |
57 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
11308535 |
tttgtgtgcgtctccagaaaattccacaaaacaa |
11308502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University