View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13984_high_24 (Length: 334)
Name: NF13984_high_24
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13984_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 51210831 - 51210601
Alignment:
| Q |
1 |
atttgaaagttgctgccacttctcaattaacggtggcatgagaatgtcaagataaacaggctgcactgaaaatagaacattggtactaaactgtgataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51210831 |
atttgaaagttgctgccacttctcaattaacggtggcatgagaatgtcaagataaacaggctgcacagaaaatagaacattggtactaaactgtgataaa |
51210732 |
T |
 |
| Q |
101 |
taactgaggagaaaagagaaaattttgggatggggaagaaggttgattagcatacctgattcagctctgccccaacagcttcagctaaagttccaacagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51210731 |
taactgaggagaaaagagaaaattttgggatggggaagaaggttgattagcatacctgattcagctctgccccaacagcttcagctaaagttccaacagc |
51210632 |
T |
 |
| Q |
201 |
atcataaacaattctgaggtttcgcctctga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51210631 |
atcataaacaattctgaggtttcgcctctga |
51210601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 226 - 316
Target Start/End: Complemental strand, 51210568 - 51210478
Alignment:
| Q |
226 |
ctctgaccatgcatatgatgagaaggacaaaatacagtgacaataaagagatggtgctcttccaaatattattcatttcaaatgaaacatc |
316 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51210568 |
ctctggccatgcatatgatgagaaggacaaaatacagtgacaataaagagatggtgctcttccaaatattattcatttcacatgaaacatc |
51210478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University