View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13984_high_37 (Length: 229)
Name: NF13984_high_37
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13984_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 13 - 207
Target Start/End: Complemental strand, 38918978 - 38918781
Alignment:
| Q |
13 |
gagagaagaagaggacgatagggttataaaccataggtgcgatttggtcgagaaaggagagttggtaatggcgaagatgggatggagttggagaagaagg |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918978 |
gagagtagaagaggacgatagggttataaaccataggcgcgatttggtcgagaaaggagagttggtaatggcgaagatgggatggagttggagaagaagg |
38918879 |
T |
 |
| Q |
113 |
tttgatgatttctttggagattatttcaacttctaacttcattcttaaa---tatatcttattgatgtttatggaacagcttcaatgtttattgtgtt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38918878 |
tttgatgatttctttggagattatttcaacttctaacttcattcttaaatagtatatcttattgatgtttatggaacagcttcaatgtttattgtgtt |
38918781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University