View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13984_high_45 (Length: 206)

Name: NF13984_high_45
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13984_high_45
NF13984_high_45
[»] chr1 (1 HSPs)
chr1 (22-189)||(7835622-7835790)


Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 22 - 189
Target Start/End: Original strand, 7835622 - 7835790
Alignment:
22 gaatacatggatgatgttgatgtcttggaatt-acctcatgcccctagtcctgtattgttaatttgcatatctaactgaatataatgataataattagag 120  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7835622 gaatacatggatgatgttgatgtcttggaatttacctcatgcccctagtcctgtattgttaatttgcatatctaactgaatataatgataataattagag 7835721  T
121 ggtataattctaattctaaagtaacatgacgagaaatagtnnnnnnnttgaccagaaaatatggaattt 189  Q
    ||||||||||||||||||||||||||||||||||||||||       ||||||||||| ||||||||||    
7835722 ggtataattctaattctaaagtaacatgacgagaaatagtaaaaaatttgaccagaaagtatggaattt 7835790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University