View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13984_low_18 (Length: 371)
Name: NF13984_low_18
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13984_low_18 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 293; Significance: 1e-164; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 39 - 371
Target Start/End: Original strand, 41399924 - 41400263
Alignment:
| Q |
39 |
taacggaatatgatatgaactgttttaaagagatgccgttaacgccgtctttttggactggtttatgggacggtgatgtcaagggtttggttagcgttcc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41399924 |
taacggaatatgatatgaactgttttaaagagatgccgttaacgccgtctttttggactggtttatgggacggtgatgtcaagggtttggtcagcgttcc |
41400023 |
T |
 |
| Q |
139 |
accgctgtcgccgttgccttccttttgtttgtcacctttagttgttgtgtgaaatttctattttaaggttccttgcatcctgataaattagagatgtgaa |
238 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41400024 |
accgctgtcgccgttaccttccttttgtttgtcacctttagttgttgtgtgaaatttctattctaaggttccttgcatcctgataaattagagatgtgaa |
41400123 |
T |
 |
| Q |
239 |
tttgtac-aattcatgaaatgatttcatttattcactaaatgtttctttggatatacttgactatttta------tatttttagattgctagtatagaaa |
331 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
41400124 |
tttgtacaaattcatgaaatgatttcatttattcactaaatgtttctttggatatacttgactattttatatttttatttttagattgctagtatcgaaa |
41400223 |
T |
 |
| Q |
332 |
aagagttgagacaaagagtttaaattctaaataaaattgt |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41400224 |
aagagttgagacaaagagtttaaattctaaataaaattgt |
41400263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 39 - 203
Target Start/End: Original strand, 41407034 - 41407198
Alignment:
| Q |
39 |
taacggaatatgatatgaactgttttaaagagatgccgttaacgccgtctttttggactggtttatgggacggtgatgtcaagggtttggttagcgttcc |
138 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||| || |||||| | |
|
|
| T |
41407034 |
taacggaatatgatatgagttgtttcaaagagatgcctttaacgccgtctttttggactggtttgtgggacggagatgtcaaggggatgtccagcgtttc |
41407133 |
T |
 |
| Q |
139 |
accgctgtcgccgttgccttccttttgtttgtcacctttagttgttgtgtgaaatttctatttta |
203 |
Q |
| |
|
|||| |||| ||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41407134 |
accgttgtctccgttatcttccttctgtttgtcacctttagttgttgtgtgaaatttctatttta |
41407198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University