View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13984_low_19 (Length: 368)
Name: NF13984_low_19
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13984_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 19 - 357
Target Start/End: Complemental strand, 37006750 - 37006412
Alignment:
| Q |
19 |
aaccactagtaaagagtggtgctgatggatatggagcaggagaggttttttgtagtgcatatgtgattttatgctacttgccatttttgaaaggattgtt |
118 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37006750 |
aaccactaataaagagtggtgctgatggatatggagcaggagaggttttttgtagtgcatatgtggttttatgctacttgccatttttgaaaggattgtt |
37006651 |
T |
|
| Q |
119 |
tgggaaaggaaaatatgggatacccttgtctacaatatgcaaatcaatggtgctagctttactatttgttcatttatgtggtaccaccattgctaattga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37006650 |
tgggaaaggaaaatatgggatacccttgtctacaatatgcaaatcaatggtgctagctttactatttgttcatttatgtggtaccaccattgctaattga |
37006551 |
T |
|
| Q |
219 |
atggtcctatattcatttatgttttttcattgtaaaagttcttcaatcttgaaagaacaatgaaaggcatcatgttcaagtataaggaaggtcttttatt |
318 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37006550 |
atggtcctaaattcatttatgttttttcattgtaaaagttcttcaatcttgaaagaacaatgaaaggcatcatgttcaagtataaggaaggtcttttatt |
37006451 |
T |
|
| Q |
319 |
caacaattatttcaacttttgacttcattcacatttcat |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37006450 |
caacaattatttcaacttttgacttcattcacatttcat |
37006412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University