View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13984_low_40 (Length: 227)
Name: NF13984_low_40
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13984_low_40 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 36 - 227
Target Start/End: Original strand, 36704004 - 36704196
Alignment:
| Q |
36 |
aacttctttcgcttattatctcatgtaagaataacacaaaa-taatggttgtttaaaaatagtaaaccgcaatgaaagtgtgaggttagtgaaaaatgga |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36704004 |
aacttctttcgcttattatctcatgtaagaataacacaaaaataatggttgtttaaaaatagtaaaccgcaatgaaagtgtgaggttagtgaaaaatgga |
36704103 |
T |
 |
| Q |
135 |
gaaattcaaccgatctatctaagttgaaaaaacaagacaacttttgtgattaaatatggagaagaataacacagtctatattctttttatttt |
227 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36704104 |
gaaattcgaccgatatatctaagttgaaaaaacaagacaacttttgtgattaaatatggagaagaataacacagtctatattctttttatttt |
36704196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University