View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13984_low_45 (Length: 221)
Name: NF13984_low_45
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13984_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 53954849 - 53955050
Alignment:
| Q |
1 |
aggtttacctttttgtctacgaagataacgaaaagaaagcttatcttatttgtacttagtcctcaaattatagagcttgagttaactaaacgtgcatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
53954849 |
aggtttacctttttgtctacgaagataacgaaaagaaagcttatcttatttgtacttagtc-tcaaattatagagcttgagctaactaaacgtgcatttt |
53954947 |
T |
 |
| Q |
101 |
gaagcaaaagagaagagtccacatagaaaacaccagtttgtcggtaggtacattccccgggggaaaggtaccacaaggacatgattgtttcacacgaagt |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53954948 |
gaagtaaaagagaagagtccacatagaaaacaccagtttgtcggtaggtacattccccgggggaaaggtaccacaaggacatgattgtttcacacgaagt |
53955047 |
T |
 |
| Q |
201 |
taa |
203 |
Q |
| |
|
||| |
|
|
| T |
53955048 |
taa |
53955050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University