View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13984_low_46 (Length: 219)
Name: NF13984_low_46
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13984_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 14 - 206
Target Start/End: Complemental strand, 43408344 - 43408151
Alignment:
| Q |
14 |
attatacttactagcaaaaagacgacccat-atagataatccaaacacaagattacattgcactacaatattatatttaactagcgtcatatatctttgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43408344 |
attatacttactagcaaaaagacgacccattatagataatccaaacacaagattacattgcactacaatattatatttaactagtgtcatatatctttga |
43408245 |
T |
 |
| Q |
113 |
tgtctagcttttgatcatgtcatctttaactaagcttgccagaaaagaaagagactgattagctactatattatagaaatttggtagaagaagc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408244 |
tgtctagcttttgatcatgtcatctttaactaagcttgccagaaaagaaagagactgattagctactatattatagaaatttggtagaagaagc |
43408151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University