View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13984_low_47 (Length: 216)
Name: NF13984_low_47
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13984_low_47 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 17 - 155
Target Start/End: Complemental strand, 13113 - 12975
Alignment:
| Q |
17 |
caaaggaaatgagagattcagataacttagaataccattgtctacttgcctgcttgaggccatatatagatttttgaagcttacataccttggttgttct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13113 |
caaaggaaatgagagattcagataacttagaataccattgtctacttgcctgcttgaggccatatatagatttttgaagctcacataccttggttgttct |
13014 |
T |
|
| Q |
117 |
agtatcggaattagagattttaatactagagggcaaaga |
155 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
13013 |
agtatcggaattagagattttaataccagggggcaaaga |
12975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University