View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13984_low_48 (Length: 206)
Name: NF13984_low_48
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13984_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 22 - 189
Target Start/End: Original strand, 7835622 - 7835790
Alignment:
| Q |
22 |
gaatacatggatgatgttgatgtcttggaatt-acctcatgcccctagtcctgtattgttaatttgcatatctaactgaatataatgataataattagag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7835622 |
gaatacatggatgatgttgatgtcttggaatttacctcatgcccctagtcctgtattgttaatttgcatatctaactgaatataatgataataattagag |
7835721 |
T |
 |
| Q |
121 |
ggtataattctaattctaaagtaacatgacgagaaatagtnnnnnnnttgaccagaaaatatggaattt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
7835722 |
ggtataattctaattctaaagtaacatgacgagaaatagtaaaaaatttgaccagaaagtatggaattt |
7835790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University