View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13985_high_19 (Length: 355)
Name: NF13985_high_19
Description: NF13985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13985_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 22 - 341
Target Start/End: Complemental strand, 7626121 - 7625793
Alignment:
| Q |
22 |
cacctacacttcacagaactctctttcaaaactctttccctcaggtactctcatgcattaacttggtgtatatatattgttttattcattcttttctgcc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7626121 |
cacctacacttcacagaactctctttcaaaactctttccctcaggtactctcatgcattaacttgttgtatatatattgttttattcattcttttctgcc |
7626022 |
T |
 |
| Q |
122 |
tctgatagtgattgtgttgcagaagcatggtagtagtagtagta---------cttttcgtagaagagaaggcatttccttcattgtcaaagctgaacaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7626021 |
tctgatagtgattgtgttgcagaagcatggtagtagtagtagtagtagtagtacttttcgtagaagagaaggcatttccttcattgtcaaagctgaacaa |
7625922 |
T |
 |
| Q |
213 |
gaactttcatcttcttcaacaggttgctttctcaaggtttcttttattttatctattgagcttgaattacagctattgttatagtatattattatgcagc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7625921 |
gaactttcatcttcttcaacaggttgctttctcaaggtttcttttattttatctattgagcttgaattacagctattgttatagtatattattatgcagc |
7625822 |
T |
 |
| Q |
313 |
atggtcactttagattgaatgtgtctctg |
341 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7625821 |
atggtcactttagattgaatgtgtctctg |
7625793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University