View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13985_high_28 (Length: 260)
Name: NF13985_high_28
Description: NF13985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13985_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 2714999 - 2715223
Alignment:
| Q |
18 |
atgcatgagattcaaagtcactacaaaattcattttcaccatattacattatgtttctatgaaccattccatgatatctagctacttgtgttgatgtcct |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2714999 |
atgcatgagattcaaagtcactataaaattcattttcaccatattacattatgtttctatgaaccattccatgatatctagctacttgtgttgatgtcct |
2715098 |
T |
 |
| Q |
118 |
tctctaccttccttgtttttgttccgcatgtcttctacaacatgacttgatgccatattatttgagggtcccccaagccccaggcatgaggcaagccaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2715099 |
tctctaccttccttgtttttgttccgcatgtcttctacaacatgacttgatgccatattatttgagggtcccccaagccccaggcatgagccaagccaat |
2715198 |
T |
 |
| Q |
218 |
tcgagacttcagccatctctctagg |
242 |
Q |
| |
|
| ||||||||||||||||||||||| |
|
|
| T |
2715199 |
tggagacttcagccatctctctagg |
2715223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University