View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13985_high_29 (Length: 259)
Name: NF13985_high_29
Description: NF13985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13985_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 25 - 256
Target Start/End: Original strand, 2246429 - 2246661
Alignment:
| Q |
25 |
tttccttcatagggtaacatcttggtagtgaaacattgagaaaattacttcctgcatcagaaactatgaagtgttacacacatgaaaaagcttgtacnnn |
124 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2246429 |
tttccttcatagggtaacatcttggcagtgaaacattgagaaaattacttcctgcataaaaaactatgaagtgttacacacatgaaaaagcttgtacttt |
2246528 |
T |
|
| Q |
125 |
nnnnnnnnnnnnn-aaatatctcttatgatatgtattttgaaagaaataaaatatgatctacttaaacattttttatccaggtttacttcactaaaacta |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2246529 |
ttttttttttttttaaatatctcttatgatatgtattttgaaagaaataaaatatgatctacttaaacattttttaaccaggtttacttcactaaaacta |
2246628 |
T |
|
| Q |
224 |
atcctcgttgaccacctttagtataatctaccc |
256 |
Q |
| |
|
|||||||||||||||||| ||||| || ||||| |
|
|
| T |
2246629 |
atcctcgttgaccaccttcagtatgatttaccc |
2246661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University