View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13985_high_30 (Length: 247)
Name: NF13985_high_30
Description: NF13985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13985_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 47251188 - 47251276
Alignment:
| Q |
1 |
aaattatgttgtgtggatgttgttcctaatccatgtcttctaacactgaccagtcaatgtccatttattcaggtctctgtcatattggt |
89 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47251188 |
aaattatgttgtgtggatgttgttcctattccatgtcttctaacactgaccagtcaatgtccatttattcaggtctctgtcatattggt |
47251276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 47251333 - 47251381
Alignment:
| Q |
149 |
tgacatgggaatttattaaatttgataaaattcaataagaatatcagtt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47251333 |
tgacatgggaatttattaaatttgataaaattcaataagaatatcagtt |
47251381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University