View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13985_high_30 (Length: 247)

Name: NF13985_high_30
Description: NF13985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13985_high_30
NF13985_high_30
[»] chr1 (2 HSPs)
chr1 (1-89)||(47251188-47251276)
chr1 (149-197)||(47251333-47251381)


Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 47251188 - 47251276
Alignment:
1 aaattatgttgtgtggatgttgttcctaatccatgtcttctaacactgaccagtcaatgtccatttattcaggtctctgtcatattggt 89  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47251188 aaattatgttgtgtggatgttgttcctattccatgtcttctaacactgaccagtcaatgtccatttattcaggtctctgtcatattggt 47251276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 47251333 - 47251381
Alignment:
149 tgacatgggaatttattaaatttgataaaattcaataagaatatcagtt 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
47251333 tgacatgggaatttattaaatttgataaaattcaataagaatatcagtt 47251381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University