View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13985_high_35 (Length: 203)
Name: NF13985_high_35
Description: NF13985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13985_high_35 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 39163705 - 39163545
Alignment:
| Q |
18 |
aagaatttaataatgtttgcattaaaatagatacccaataaataaatgcatatactaaaatattgaatgggtcccacaaatgtgctgacggataattaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39163705 |
aagaatttaataatgtttgcattaaaatatatacccaataaataaatgcatatactaaa--------tgggtcccacaaatgtgctgacggataattaag |
39163614 |
T |
 |
| Q |
118 |
ttgattgaggttgttcgcacccaatcatttcatttccagcaaataacgaacgaacgatgatgatgatct |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39163613 |
ttgattgaggttgttcgcacccaatcatttcatttccagcaaataacgaacgaacgatgatgatgatct |
39163545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University