View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13985_low_27 (Length: 267)
Name: NF13985_low_27
Description: NF13985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13985_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 18 - 255
Target Start/End: Complemental strand, 33601188 - 33600951
Alignment:
| Q |
18 |
atatattgcctaagcaatccttttctctttattctacatggaatattgatatcattatcatcataatatcatcttagtattattaattatcttttacagt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33601188 |
atatattgcctaagcaatccttttctctttattctacatggaatatttatatcattatcatcataatatcatcttagtattattaattatcttttacagt |
33601089 |
T |
|
| Q |
118 |
tcagtgattattcagtcagaagctcagtgatcgggttgaatattaactgttcattaacctttcttttcctttttctcacctatatatatgaaccctatgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33601088 |
tcagtgattattcagtcagaagctcagtgatcgggttgaatattaactgttcattaacctttcttttcctttttctcacctatatatatgacccctatgt |
33600989 |
T |
|
| Q |
218 |
ctgtgtacattattggacagtgataatactcactattc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33600988 |
ctgtgtacattattggacagtgataatactcactattc |
33600951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University