View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13985_low_28 (Length: 265)
Name: NF13985_low_28
Description: NF13985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13985_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 23 - 249
Target Start/End: Original strand, 43408095 - 43408322
Alignment:
| Q |
23 |
aatggaatgcactgctccagcagcaaatcatgatgatcagcag-aaagtggttttgttgttgggaagagatggtggattgggcctagggcaaatccaggt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408095 |
aatggaatgcactgctccagcagcaaatcatgatgatcagcaggaaagtggttttgttgttgggaagagatggtggattgggcctagggcaaatccaggt |
43408194 |
T |
|
| Q |
122 |
ccaacaacatctgtcaaagaaagattagtggttgctgttggttacttaaaagagtacacaaagaactcatccaacaacgtccttattcagatatgggtac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408195 |
ccaacaacatctgtcaaagaaagattagtggttgctgttggttacttaaaagagtacacaaagaactcatccaacaacgtccttattcagatatgggtac |
43408294 |
T |
|
| Q |
222 |
ctatgaggaggagatcagccctaattca |
249 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43408295 |
ctatgaggaggagatcagccctaattca |
43408322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University