View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13985_low_35 (Length: 212)
Name: NF13985_low_35
Description: NF13985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13985_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 60 - 194
Target Start/End: Original strand, 54498059 - 54498194
Alignment:
| Q |
60 |
gtgtgtctatgttttacctcaaaataagattggccagaaccaaaaataaagtcgacatcaccttgaatataacataaca-gtctttaaagtagtgtcgtc |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54498059 |
gtgtgtctatgttttacctcaaaataagattggccagaaccaaaaataaagtcgacatcaccttgaatataacataacatgtctttaaagtagtgtcgtc |
54498158 |
T |
|
| Q |
159 |
cctttgctgcaatcaaagtatcttgataactcataa |
194 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54498159 |
cctttgctgcaaacaaagtatcttgataactcataa |
54498194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 73 - 133
Target Start/End: Complemental strand, 18744478 - 18744418
Alignment:
| Q |
73 |
ttacctcaaaataagattggccagaaccaaaaataaagtcgacatcaccttgaatataaca |
133 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||| || ||||||||||||||||| |
|
|
| T |
18744478 |
ttacctcaaaataagattgggcttgaccaaaaatgaagtcaacttcaccttgaatataaca |
18744418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University