View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13986_low_10 (Length: 223)

Name: NF13986_low_10
Description: NF13986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13986_low_10
NF13986_low_10
[»] chr1 (1 HSPs)
chr1 (1-208)||(31453407-31453614)


Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 31453407 - 31453614
Alignment:
1 agagaattgagcgatagtttcagatacccatagttttaatctttgctaaacctttcactatcgctttttctctgttctttaannnnnnnagggttagggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||    
31453407 agagaattgagcgatagtttcagatacccatagttttaatctttgctaaacctttcactatcgctttttctctgttctttaatttttttagggttagggt 31453506  T
101 ttgaaacggaattaagcgatggttttgggatacccaattgggggttgattataaagttttaatctttgatgtgtctgnnnnnnnncttcccctgattaca 200  Q
    ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||    
31453507 ttgaaacggaactatgcgatggttttgggatacccaattgggggttgattataaagttttaatctttgatgtgtctgttttttttcttcccctgattaca 31453606  T
201 tgtttttt 208  Q
    ||||||||    
31453607 tgtttttt 31453614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University