View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13986_low_10 (Length: 223)
Name: NF13986_low_10
Description: NF13986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13986_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 31453407 - 31453614
Alignment:
| Q |
1 |
agagaattgagcgatagtttcagatacccatagttttaatctttgctaaacctttcactatcgctttttctctgttctttaannnnnnnagggttagggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31453407 |
agagaattgagcgatagtttcagatacccatagttttaatctttgctaaacctttcactatcgctttttctctgttctttaatttttttagggttagggt |
31453506 |
T |
 |
| Q |
101 |
ttgaaacggaattaagcgatggttttgggatacccaattgggggttgattataaagttttaatctttgatgtgtctgnnnnnnnncttcccctgattaca |
200 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31453507 |
ttgaaacggaactatgcgatggttttgggatacccaattgggggttgattataaagttttaatctttgatgtgtctgttttttttcttcccctgattaca |
31453606 |
T |
 |
| Q |
201 |
tgtttttt |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
31453607 |
tgtttttt |
31453614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University