View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13986_low_14 (Length: 219)
Name: NF13986_low_14
Description: NF13986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13986_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 15630878 - 15630659
Alignment:
| Q |
1 |
accacacaaagaatcattgtatggagttgaaatgggagtagcagtagta---aggagtaaattttttagcttagattgttgagatatgagagcttgaact |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15630878 |
accacacaaagaatcattgtatggagttgaaatgggagtagtagtagtagtaaggagtaaattttttagcttagattgttgagatatgagagcttgaact |
15630779 |
T |
 |
| Q |
98 |
gctgatttcgatggaaatttcgtgttctttgaaaggtgtagacatgcttgcggttaaagcttctcgtaatttaaaccacagcatatctttatcctttcat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15630778 |
gctgatttcgatggaaatttcgtgttctttgaaaggtgtagacatgcttgcggtgaaagcttctcgtaatttaaaccacagcatatctttatcctttcat |
15630679 |
T |
 |
| Q |
198 |
cttttgacagttgaggatgt |
217 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
15630678 |
cttgtgacagttgaggatgt |
15630659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University