View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13986_low_9 (Length: 227)
Name: NF13986_low_9
Description: NF13986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13986_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 7 - 221
Target Start/End: Original strand, 30435735 - 30435937
Alignment:
| Q |
7 |
cctggtaccagttgcttgaccattgtctccccaaaccaaatgtccagaacctaatgttaaaggtattatgcttcatctataaatgatgtctggtttaatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30435735 |
cctggtaccagttgcttgaccattgtctccccaaaccaaatgtccagaacctaatgttaaaggtattatgcttcatctataaatgatg------------ |
30435822 |
T |
 |
| Q |
107 |
aatagcaatggaagcatga---ggtagttaaaggatagtgcagcttctaatttctcttgttannnnnnnatccttcctttgacaggttttactaaaccag |
203 |
Q |
| |
|
||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30435823 |
--tagcaatagaagcatgagggggtagttaaa-gatagtgcagcttctaatttctcttgttatttttttatccttcctttgacaggttttactaaaccag |
30435919 |
T |
 |
| Q |
204 |
gttgtattgggtccatgt |
221 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30435920 |
gttgtattgggtccatgt |
30435937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University