View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13987_high_17 (Length: 224)
Name: NF13987_high_17
Description: NF13987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13987_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 11 - 203
Target Start/End: Original strand, 40045694 - 40045886
Alignment:
| Q |
11 |
agataatactgctaaagtgttggaacaaaagagggaaatgactagtagggttagtgagatgcattgttttttatttgtcatcattttgggctatattgaa |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40045694 |
agataatgctgctaaagtgttggaacaaaagagggaaatgactagtagggttagtgagatgcattgttttttatttgtcaacattttgggctatattgaa |
40045793 |
T |
 |
| Q |
111 |
atgattgaattgtgcttgtaaaatgagtgaagggttgatgaattttagagacatggattatgttgttttatattgagttttgtggacaattat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40045794 |
atgattgaattgtgcttgtaaaatgagtgaagggttgatgaattttagagacatggattatgttgttttatattgagttttgtggacaattat |
40045886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University