View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13988_high_3 (Length: 560)
Name: NF13988_high_3
Description: NF13988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13988_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-131; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 282 - 544
Target Start/End: Original strand, 50529771 - 50530039
Alignment:
| Q |
282 |
atcatatcgtgtttgttgtctgtgactgtgcttaatggtgg------atgttgatcaagaaggatcagttacaaacctgtagcagataaccactgtgatg |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529771 |
atcatatcgtgtttgttgtctgtgactgtgcttagtggtggatgtggatgttgatcaagaaggatcagttacaaacctgtagcagataaccactgtgatg |
50529870 |
T |
 |
| Q |
376 |
agtaaaacaacaacgacagcaaccaagtcgatttggttaaacccttccggaaaagaaggaacggtgatcctccatttagcagaagagacaccgactgtgg |
475 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529871 |
agtaaaacaacaacgacagcaaccaagtcgatttggttaaacccttccggaaaagaaggaacggtgatcctccatttagcagaagagacaccgactgtgg |
50529970 |
T |
 |
| Q |
476 |
tgccgacgtacttggtgaaacctctggcaactgcagcatttgacatcacgtaatccatgatgagatttg |
544 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50529971 |
tgccgacgtacttggtgaaacctctagcaactgcagcatttgacatcacgtaatccatgatgagatttg |
50530039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 15 - 89
Target Start/End: Original strand, 50529496 - 50529570
Alignment:
| Q |
15 |
tgctatgaacagtatgtgcaaccccgtcaatatcatattcaccaccgaactttccctcgtactgacaaactgaac |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||| |
|
|
| T |
50529496 |
tgctatgaacagtatgtgcaaccccgtcaatatcatattcaccaccgaactttccttcgtactgaaaaattgaac |
50529570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 123 - 190
Target Start/End: Original strand, 50529617 - 50529684
Alignment:
| Q |
123 |
tgagctccattgtaaatgatgaactcatggcaccggcacctctgataaaggtgtgtccgatgtctgag |
190 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
50529617 |
tgagctccattgtaaatgatgaactcatagcaccggcacctctgatcaaagtgtgtccgatgtctgag |
50529684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University