View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13989_high_14 (Length: 266)
Name: NF13989_high_14
Description: NF13989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13989_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 253
Target Start/End: Original strand, 28228115 - 28228349
Alignment:
| Q |
19 |
aaatcacggatagaaaaggatgtgggggcaaatagaatatagcaatcaagcataactgctagatgctttccctaaatcaggttggcaaaattaggttatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28228115 |
aaatcacggatagaaaaggatgtgggggcaaatagaatatagcaatcaagcataactgctagatgctttccctaaatcaggttggcaaaattaggttatc |
28228214 |
T |
|
| Q |
119 |
tattttatagacgccacatctaagatggactcttgtgatgtaggagtacgaatcctctcaccagttccaataggtttctttgtgtggctggatcttgccc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28228215 |
tattttatagacgccacatctaagatggactcttgtgatgtaggagtacgaatcctctcaccagttccaataggtttctttgtgtggctggatcttgccc |
28228314 |
T |
|
| Q |
219 |
aataattacactttgaatgttcttttccttagcct |
253 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28228315 |
aataattacactttgaatgctcttttccttagcct |
28228349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University